Jump to a section

Biology - Molecular Basis of Inheritance

Practise 39 NEST (NISER) previous year questions on Molecular Basis of Inheritance, compiled from papers spanning 2011 to 2026. Each question is pulled directly from the actual exam paper it appeared in, so you're practising in the exact style and difficulty NEST (NISER) tests.

Molecular Basis of Inheritance has been asked in 15 of the 16 years of NEST (NISER) papers analysed (2011–2026), with 39 questions in all. 3% of them were easy, 82% moderate and 15% tough. Most of its questions came from 2021, with 7 questions that year. In the last three years (2024–2026) it had 6 questions across 4 papers, about 1.5 per paper.

The chapter's 10 topics are not weighted equally: Regulation of Gene Expression (7 questions, 18%), Genetic Code (6 questions, 15%), and Replication (6 questions, 15%) have been asked the most. Over the last five years the most frequent topics have been Transcription (2), Replication (2), and Structure of DNA (2). Regulation of Gene Expression has produced the most tough questions (3).

  1. 1In an experiment, bacteria were grown for generations in a medium containing (light isotope), then transferred to a medium with (heavy isoto2026Replication
  2. 2Shotgun method was used for sequencing a stretch of DNA wherein the molecule was broken into small fragments and each fragment was sequenced2025DNA Fingerprinting
  3. 3In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows t2025Regulation of Gene Expression
  4. 4An unknown organism that can utilise as nitrogen source was grown for several generations under four different conditions as given below: (i2024 (Session 1)Replication
  5. 5The central dogma of molecular biology states that the information flow starts from genome. Consider the following statements: (i) Mutation 2024 (Session 2)Central Dogma
  6. 6A researcher has cloned a bacteriophage (phage) gene into a bacterial vector under the control of a phage promoter. To express this gene in 2024 (Session 2)Transcription
  7. 7A 1000 base pair double-stranded DNA (B form) has a melting temperature of . If a duplex RNA (A form) of the same length and sequence is con2023 (Session 1)Structure of DNA
  8. 8If the transcription unit of a gene has its promoter and terminator arranged as shown below then, the sequence of mRNA transcribed from this2022 (Session 1)Transcription
  9. 9Deoxyribonucleic acid (DNA) is a polymer composed of the nucleotides, deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP)2022 (Session 2)Structure of DNA
  10. 10Similarity between DNA sequences of two eukaryotic species is used to predict their evolutionary relatedness, pointing to a shared ancestry.2021 (Session 1)The Search for Genetic Material
  11. 11An autosomal dominant muscular dystrophy is caused by a decrease in the repeat number of a VNTR present on chromosome 4 of humans. Each repe2021 (Session 1)DNA Fingerprinting
  12. 12A linear double-stranded DNA was completely digested using either one or two restriction endonucleases ( and BanII). The sequence of one of 2021 (Session 1)DNA Fingerprinting
  13. 13Escherichia coli strains (I-IV) with mutations in the lac operon were studied for galactosidase activity, followed by measuring its mRNA and2021 (Session 1)Regulation of Gene Expression
  14. 14A double-stranded DNA template with sequence 5'GCCATGAACTAGCTTCGATCGATGCTTGCCTACGTCAGTC3' was PCR-amplified using forward (5'GAACTA3') and r2021 (Session 2)Replication
  15. 15DNA fingerprinting was performed on a human skeleton (S) to identify a missing person reported by four different families (F1, F2, F3 and F42021 (Session 2)DNA Fingerprinting
  16. 16The CENTN1 gene encodes the protein centrin that is localized to the centriolar apparatus. Mutation in this gene may give rise to dysfunctio2021 (Session 2)Mutation
  17. 17A drug inhibits DNA replication in the bacterium . coli by specifically blocking the catalytic site of DNA polymerase activity. That the sam2020 (Session 2)Replication
  18. 18Arrange the following biological discoveries in the correct chronology from the earliest to the latest. i. British biochemist Frederick Sang2019 (Session 1)The Search for Genetic Material
  19. 19DNA analysis is based upon the principles of DNA renaturation kinetics. The rate at which heat-denatured DNA sequences in solution will rena2019 (Session 1)Properties of Genetic Material
  20. 20Proteins P1 and P2 bind to each other to form a complex. This complex has a high binding affinity to a specific element on the promoter sequ2019 (Session 1)Regulation of Gene Expression
  21. 21Following is the sequence of a gene that produces peptide ' P ' and has a promoter sequence in the 5' upstream region of the sense strand an2019 (Session 1)Genetic Code
  22. 22If the ratio in one strand of DNA is 0.7 , the same ratio in the complementary strand will be2019 (Session 2)Structure of DNA
  23. 23The sequence of a double stranded DNA, which produces a pentapeptide is given below: The correct mRNA sequence corresponding to the pentapep2018Genetic Code
  24. 24Khorana performed experiments to decipher the codons that code for a particular amino acid. The results of these experiments using synthetic2018Genetic Code
  25. 25In biological systems, proteins (repressors and activators) control gene expression. Repressors bind to promoters and inhibit gene expressio2018Regulation of Gene Expression
  26. 26The relative percentages of nitrogenous bases of the genetic material isolated from various species ( and T) are listed in the following tab2017Structure of DNA
  27. 27A student wants to construct a plasmid 'BacLight', that when transformed into a bacterium will produce light IF AND ONLY IF the sugar lactos2017Regulation of Gene Expression
  28. 28Which of the following pairs is an incorrect match?2016Regulation of Gene Expression
  29. 29For the peptide sequence (from N to C terminus) Lys-Arg-Ser-Cys-Tyr-Tyr-Trp-HisLys (KRSCYYWHK), which of the following is the correct coding2016Genetic Code
  30. 30In a plant breeding experiment, scientists crossed two homozygous parental lines (P1 and P2) to produce F1 hybrids, designated as F1- P1/P2.2014DNA Fingerprinting
  31. 31A short peptide has a sequence of amino acids valine-serine-methionine-proline, and the t-RNAs used in its synthesis have the following corr2013Genetic Code
  32. 32Two different DNA samples were isolated from biological specimens. Further experiments demonstrated that one of these (X) was composed of an2013Structure of DNA
  33. 33In an in vitro transcription experiment, the transcript and both the strands of DNA were separated and analyzed for their base composition. 2012Transcription
  34. 34Telomeres are nucleotide sequences at the ends of DNA molecules of eukaryotic cells. Since linear chromosomal DNA gets shortened naturally a2012Replication
  35. 35The results obtained after following the experimental design of Meselson and Stahl to study DNA replication are shown in the adjacent figure2012Replication
  36. 36An operon comprises of regulatory DNA sequences such as activator and repressor binding sites near the promoter and controls the transcripti2012Regulation of Gene Expression
  37. 37Sequence of the coding strand in a transcription unit is -ACGGTTACAAGCT- . What would be the sequence of mRNA transcribed from this transcri2011Transcription
  38. 38Which of the following statements is NOT TRUE for RNA ?2011Transcription
  39. 39Protein synthesis most often starts at AUG as a start codon and terminates at UAA, UAG and UGA as stop codons. Each codon specifies only one2011Genetic Code

Frequently Asked Questions

1.How many questions are available for Molecular Basis of Inheritance?

This chapter includes 39 questions compiled from NEST (NISER) papers spanning 2011 to 2026.

2.Are these questions only from NEST (NISER), or from other exams too?

These are NEST (NISER) questions specifically for the Molecular Basis of Inheritance chapter. Questions from other exams like JEE Main or NTA Abhyas (JEE Main) are organised separately under their respective exam sections.

3.Is Molecular Basis of Inheritance an important chapter for NEST (NISER) Biology?

Molecular Basis of Inheritance has appeared in 15 of the 16 years of NEST (NISER) papers covered here, with 39 questions across 19 papers - about 2 per paper it appears in.

4.What is the difficulty level of Molecular Basis of Inheritance questions in NEST (NISER)?

Of the 39 questions analysed for this chapter, 3% are easy, 82% moderate and 15% tough. 2021 had the most, with 7 questions.

5.Which topics in Molecular Basis of Inheritance should I focus on?

These topics have carried the most weightage in Molecular Basis of Inheritance:

  • Regulation of Gene Expression - 7 questions (18%)
  • Genetic Code - 6 questions (15%)
  • Replication - 6 questions (15%)
  • Regulation of Gene Expression has produced the most tough questions (3).
6.Is Molecular Basis of Inheritance's weightage in NEST (NISER) going up or down?

Across all 19 papers analysed, Molecular Basis of Inheritance has averaged about 2.1 questions per paper. In the last three years (2024–2026), that average has fallen, at about 1.5 questions per paper. Use the year-wise numbers on this page for the exact trend before you decide how much time to give it.