A linear double-stranded DNA was completely digested using either one or two restriction endonucleases ( $\mathrm{C} f r 10 \mathrm{I}$ and BanII). The sequence of one of the strands is provided. The restriction site for Cfr10I is RCCGGY and for BanII is GRGCYC ( $\mathbf{R}$ is A or G and $\mathbf{Y}$ is T or C ).

5'TGGAGAGACCGGTAGCAGAGAGCTCCATTCCGGGCGCGCCGGCACCCTTAGGA3'
Based on this information, the correct option is

• A

  Digestion with both C fri0I and BanII will generate three fragments.
• Correct answer
  B

  Digestion with both Cfr10I and BanII will generate four fragments.
• C

  Digestion with BanII will generate one fragment.
• D

  Digestion with Cfr10I will generate two fragments.

Hence, the correct answer is option: 'B'.