Q4 / 55 · NEST (NISER) 2012 · Biology

The results obtained after following the experimental design of Meselson and Stahl to study DNA replication are shown in the adjacent figure. These results suggest that the mode of DNA replication is

Correct answer
A
conservative.
B
semi-conservative
C
dispersive
D
none of the these.

Hence, the correct answer is option: 'A'.

More Molecular Basis of Inheritance Questions

An unknown organism that can utilise as nitrogen source was grown for several generations under four different conditions as given below: (i2024 (Session 1)Replication
A double-stranded DNA template with sequence 5'GCCATGAACTAGCTTCGATCGATGCTTGCCTACGTCAGTC3' was PCR-amplified using forward (5'GAACTA3') and r2021 (Session 2)Replication
A drug inhibits DNA replication in the bacterium . coli by specifically blocking the catalytic site of DNA polymerase activity. That the sam2020 (Session 2)Replication
In an experiment, bacteria were grown for generations in a medium containing (light isotope), then transferred to a medium with (heavy isoto2026Replication
Shotgun method was used for sequencing a stretch of DNA wherein the molecule was broken into small fragments and each fragment was sequenced2025DNA Fingerprinting
In the lac-operon system, lactose acts as an inducer that binds to the repressor protein attached to the operator region (lacO) and allows t2025Regulation of Gene Expression