Jump to a section

NEET 2024

Browse the complete Botany, Chemistry, Physics, and Zoology question set from the NEET 2024 paper, question by question. Each question shows a quick preview so you can jump straight to the topic or subject you want to revise. Click through to attempt the full question in practice mode, or head back to the paper-wise list to download the entire paper as a PDF.

This paper has 200 questions in total - 75 easy (38%), 113 moderate (56%) and 12 tough (6%). That's a fairly typical mix for this exam. By subject: Physics 36% easy, 58% moderate, 6% tough; Chemistry 50% easy, 36% moderate, 14% tough; Zoology 35% easy, 65% moderate, 0% tough; Botany 28% easy, 67% moderate, 4% tough.

Botany questions were spread across 14 chapters, with Biodiversity and its Conservation (7), Biomolecules (B) (5), and Morphology of Flowering Plants (5) carrying the most weight. Chemistry questions were spread across 22 chapters, with Chemical Bonding and Molecular Structure (4), General Organic Chemistry (4), and d and f Block Elements (4) carrying the most weight. Physics questions were spread across 28 chapters, with Current Electricity (3), Magnetic Effects of Current (3), and Semiconductors (3) carrying the most weight. Zoology questions were spread across 17 chapters, with Biotechnology - Principles and Processes (6), Molecular Basis of Inheritance (6), and Human Reproduction (5) carrying the most weight.

Botany

  1. 1Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin2024Plant Growth Regulators
  2. 2Lecithin, a small molecular weight organic compound found in living tissues, is an example of:2024Lipids
  3. 3Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of water lily are not2024Sexual Reproduction
  4. 4List of endangered species was released by2024Loss of Biodiversity
  5. 5Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. D. ATP E. NADPH Choose the correct a2024Mechanism of Photosynthesis
  6. 6The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they c2024Conservation of Biodiversity
  7. 7In the given figure, which component has thin outer walls and highly thickened inner walls?2024Transpiration
  8. 8Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and2024The Flower
  9. 9Which of the following is an example of actinomorphic flower?2024The Flower
  10. 10Which one of the following is not a criterion for classification of fungi?2024Kingdom Fungi
  11. 11Match List I with List II {array}{|l|l|l|l|} & List-I & & List-II \\ A. & Rhizopus & I. & Mushroom \\ B. & Ustilago & II. & Smut fungus \\ C2024Kingdom Fungi
  12. 12Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:2024Enzymes
  13. 13Formation of interfascicular cambium from fully developed parenchyma cells is an example for2024Secondary Growth
  14. 14How many molecules of ATP and NADPH are required for every molecule of fixed in the Calvin cycle?2024Mechanism of Photosynthesis
  15. 15The capacity to generate a whole plant from any cell of the plant is called:2024Conservation of Biodiversity
  16. 16Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of 2024Patterns of Biodiversity
  17. 17Match List I with List II Choose the correct answer from the options given below:2024Cell Organelles
  18. 18Identify the part of the seed from the given figure which is destined to form root when the seed germinates.2024The Root
  19. 19Spindle fibers attach to kinetochores of chromosomes during2024M-phase (Mitotic Phase)
  20. 20Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage. Statement 2024Meiosis
  21. 21Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem ves2024Permanent Tissues
  22. 22These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation2024Loss of Biodiversity
  23. 23Bulliform cells are responsible for2024Anatomy of Leaf
  24. 24The cofactor of the enzyme carboxypeptidase is:2024Enzymes
  25. 25Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usual2024Kingdom Fungi
  26. 26Match List I with List II Choose the correct answer from the options given below:2024Patterns of Biodiversity
  27. 27Given below are two statements: Statement I: In plants, some binds to RuBisCO, hence fixation is decreased. Statement II: In plants, mesophy2024Mechanism of Photosynthesis
  28. 28The DNA present in chloroplast is:2024Cell Organelles
  29. 29In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is , what would be the GPP (Gross Primary Productivity) of the 2024Functions of Ecosystem
  30. 30Which of the following are fused in somatic hybridization involving two varieties of plants?2024Conservation of Biodiversity
  31. 31Match List I with List II {array}{|l|l|c|l|} & List I & & List II \\ A. & Citric acid cycle & I. & Cytoplasm \\ B. & Glycolysis & II. & Mito2024Aerobic Respiration
  32. 32Match List I with List II Choose the correct answer from the options given below:2024The Flower
  33. 33Identify the correct description about the given figure:2024Sexual Reproduction
  34. 34Match List-I with List-II Choose the correct answer from the options given below.2024Enzymes
  35. 35Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.2024Aerobic Respiration
  36. 36Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?2024Plant Growth Regulators
  37. 37Match List I with List II Choose the correct answer from the options given below :2024The Flower
  38. 38Match List I with List II : Choose the correct answer from the options given below :2024Cell Organelles
  39. 39Match List I with List II : {array}{|l|l|l|l|} & List I & & List II \\ A. & Pleurobrachia & I. & Mollusca \\ B. & Radula & II. & Ctenophora 2024Phylum Mollusca
  40. 40Match List I with List II : Choose the correct answer from the options given below2024Meiosis
  41. 41Match List I with List II : Choose the correct answer from the options given below :2024Phylum Chordata
  42. 42Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. P2024Phylum Annelida
  43. 43Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the corre2024Interphase
  44. 44Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme r2024Enzymes
  45. 45Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membr2024Cell Organelles
  46. 46The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous sys2024Phylum Chordata

Chemistry

  1. 1The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN D2024Preparation and Reactions of Glucose
  2. 2The energy of an electron in the ground state for ion is , then that for an electron in state for ion in J is2024Bohr's model
  3. 3Which reaction is NOT a redox reaction?2024Balancing of redox reactions
  4. 4Match List I with List II. Choose the correct answer from the options given below:2024First Law and Basic Fundamentals of Thermodynamics
  5. 5For the reaction . At a given time, the composition of reaction mixture is: . Then, which of the following is correct?2024Law of Mass Action, Equilibrium Constant (Kc and Kp) and its Application
  6. 6Match List I with List II. Choose the correct answer from the options given below:2024Isomerism of coordination compounds
  7. 7In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 2024Entropy and Second law of thermodynamics
  8. 8Identify the correct reagents that would bring about the following transformation.2024Reactions of alkenes
  9. 9Match List I with List II. Choose the correct answer from the options given below:2024Preparation and Properties of Carboxylic Acids
  10. 10In which of the following equilibria, and are NOT equal?2024Law of Mass Action, Equilibrium Constant (Kc and Kp) and its Application
  11. 11Which one of the following alcohols reacts instantaneously with Lucas reagent?2024Reactions of Alcohols
  12. 12Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane isopentane neopentane2024Classification of organic compounds
  13. 13Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot be 2024Preparation and Properties of Amines
  14. 14The value for the couple is more positive than that of or due to change of2024Properties of D-block elements
  15. 15On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purific2024Purification of Organic Compounds
  16. 16Fehling's solution ' ' is2024Tests for Aldehyde and Ketones
  17. 17Match List I with List II. Choose the correct answer from the options given below:2024Covalent and Co-ordinate Bonding
  18. 18Intramolecular hydrogen bonding is present in2024Van Der Waals Forces, Hydrogen Bonding and Metallic Bonding
  19. 19The highest number of helium atoms is in2024Mole concept
  20. 20Match List I with List II. Choose the correct answer from the options given below:2024Oxidation and Reduction Reactions
  21. 21Among Group 16 elements, which one does NOT show -2 oxidation state?2024Oxygen and Its Compounds
  22. 22'Spin only' magnetic moment is same for which of the following ions? A. B. C. D. E. Choose the most appropriate answer from the options give2024Properties of D-block elements
  23. 23A compound with a molecular formula of has two tertiary carbons. Its IUPAC name is :2024IUPAC Nomenclature
  24. 24The Henry's law constant values of three gases in water are and 35 kbar , respectively. The solubility of these gases in water follow the or2024Henry's law
  25. 25The compound that will undergo reaction with the fastest rate is2024Preparation and Properties of Monohalides
  26. 26The most stable carbocation among the following is :2024Reaction Intermediates
  27. 27Given below are two statements : Statement I: Both and complexes are octahedral but differ in their magnetic behaviour. Statement II: is dia2024Werner's theory and Valence Bond Theory
  28. 281 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to2024Concentration terms
  29. 29Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order Statement II: On the basis 2024Oxygen and Its Compounds
  30. 30Arrange the following elements in increasing order of first ionization enthalpy: Choose the correct answer from the options given below:2024Periodic properties
  31. 31Activation energy of any chemical reaction can be calculated if one knows the value of2024Arrhenius theory
  32. 32Arrange the following elements in increasing order of electronegativity: Choose the correct answer from the options given below:2024Periodic properties
  33. 33Match List I with List II Choose the correct answer from the options given below :2024Quantum mechanical model
  34. 34Match List I with List II. Choose the correct answer from the options given below:2024Hybridisation and VSEPR Theory
  35. 35Which plot of vs is consistent with Arrhenius equation?2024Arrhenius theory
  36. 36The work done during reversible isothermal expansion of one mole of hydrogen gas at from pressure of 20 atmosphere to 10 atmosphere is (Give2024First Law and Basic Fundamentals of Thermodynamics
  37. 37Identify the correct answer.2024Dipole moment
  38. 38Major products A and B formed in the following reaction sequence, are2024Preparation and Properties of Monohalides
  39. 39The pair of lanthanoid ions which are diamagnetic is2024F-Block elements
  40. 40A compound contains of of and remaining percentage of . Then, the empirical formula of X is : (Given atomic masses of )2024Quantitative measures in chemical equations
  41. 41Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI . A. B. C. D. E.2024Identification of Basic Radicals
  42. 42Consider the following reaction in a sealed vessel at equilibrium with concentrations of and . If 0.1 mol of is taken in a closed vessel, wh2024Law of Mass Action, Equilibrium Constant (Kc and Kp) and its Application
  43. 43The rate of a reaction quadruples when temperature changes from to . Calculate the energy o activation. Given2024Arrhenius theory
  44. 44During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of io2024Compounds of Transition Metals
  45. 45Identify the major product C formed in the following reaction sequence:2024Preparation and Properties of Amides
  46. 46Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Gi2024Cells and Electrode Potential, Nernst Equation
  47. 47For the given reaction: 'P' is2024Preparation and Properties of Carboxylic Acids
  48. 48Given below are two statements : Statement I : is a homoleptic complex whereas is a heteroleptic complex. Statement II : Complex has only on2024Terminology of coordination compounds
  49. 49The plot of osmotic pressure vs concentration ( ) for a solution gives a straight line with slope 25.73 . The temperature at which the osmot2024Colligative Properties and Abnormal Molecular Masses
  50. 50The products A and B obtained in the following reactions, respectively, are2024Phosphorus and Its Compounds

Physics

  1. 1A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is in the direction shown, which one 2024Rolling without Slipping
  2. 2Match List I with List II. {array}{|l|l|l|l|} & {|c|}{ {array}{c} List I \\(Spectral Lines of \ for \ from) {array}} & & {|c|}{ {array}{l} L2024Atomic Spectrum
  3. 3A thermodynamic system is taken through the cycle . The work done by the gas along the path is:2024Thermodynamic Processes
  4. 4The terminal voltage of the battery, whose emf is 10 V and internal resistance , when connected through an external resistance of as shown i2024Electric Cell or Battery
  5. 5In an ideal transformer, the turns ratio is . The ratio is equal to (the symbols carry their usual meaning) :2024Transformers
  6. 6A light ray enters through a right angled prism at point with the angle of incidence as shown in figure. It travels through the prism parall2024Prism and Dispersion of Light
  7. 7The quantities which have the same dimensions as those of solid angle are:2024Dimensions
  8. 8A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is , then the excess forc2024Surface tension
  9. 9Given below are two statements: one is labelled as Assertion and the other is labelled as Reason . Assertion A: The potential at any axial p2024Electric Dipole
  10. 10In a uniform magnetic field of 0.049 T , a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of2024Magnetic Moment
  11. 11If the monochromatic source in Young's double slit experiment is replaced by white light, then2024Youngs Double Slit Experiment
  12. 12Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. S2024Atomic Structure
  13. 13The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are and , is:2024Young's Modulus and Breaking Stres
  14. 14Consider the following statements A and B and identify the correct answer: A. For a solar-cell, the I-V characteristics lies in the IV quadr2024Special purpose diodes
  15. 15A particle moving with uniform speed in a circular path maintains:2024Uniform Circular Motion
  16. 16If is the velocity of light in free space, the correct statements about photon among the following are: A. The energy of a photon is . B. Th2024Photoelectric Effect
  17. 17Two bodies and of same mass undergo completely inelastic one dimensional collision. The body moves with velocity while body is at rest befor2024Collisions
  18. 18The graph which shows the variation of and its kinetic energy, is (where is de Broglie wavelength of a free particle):2024Matter Waves
  19. 19An unpolarised light beam strikes a glass surface at Brewster's angle. Then2024Polarization of Light
  20. 20At any instant of time , the displacement of any particle is given by (SI unit) under the influence of force of 5 N . The value of instantan2024Power
  21. 21A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A . The magnitude of the magnetic field at the centre of the coil is (2024Magnetic Field
  22. 22The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is . The length of the 400 g ro2024Moment of inertia of rigid bodies
  23. 23A bob is whirled in a horizontal plane by means of a string with an initial speed of rpm. The tension in the string is . If speed becomes wh2024Uniform Circular Motion
  24. 24Match List-I with List-II. Choose the correct answer from the options given below2024Magnetic Materials and their Properties
  25. 25In the following circuit, the equivalent capacitance between terminal and terminal is :2024Grouping of capacitors
  26. 26A horizontal force 10 N is applied to a block as shown in figure. The mass of blocks and are 2 kg and 3 kg respectively. The blocks slide ov2024Newton's laws of motion
  27. 27In the nuclear emission stated above, the mass number and atomic number of the product respectively, are2024Radioactivity
  28. 28In a vernier callipers, divisions of vernier scale coincide with divisions of main scale. If 1 MSD represents 0.1 mm , the vernier constant 2024Experimental Physics
  29. 29If represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are2024Simple Harmonic Motion
  30. 30In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and t2024Magnetic Flux, Faraday's and Lenz law
  31. 31A logic circuit provides the output as per the following truth table : {array}{|l|l|l|} & B & Y \\ 0 & 0 & 1 \\0 & 1 & 0 \\1 & 0 & 1 \\1 & 12024Logic gates
  32. 32A wire of length ' 1 and resistance is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are con2024Combination of Resistances
  33. 33The output ( ) of the given logic gate is similar to the output of an/a2024Logic gates
  34. 34A thin spherical shell is charged by some source. The potential difference between the two points and (in V ) shown in the figure is: (Take 2024Electric Potential and Potential Energy
  35. 35The mass of a planet is th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:2024Acceleration Due to Gravity
  36. 36The minimum energy required to launch a satellite of mass from the surface of earth of mass and radius in a circular orbit at an altitude of2024Motion of satellite
  37. 37A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm . The magnifying power of telescope for vi2024Optical Instruments
  38. 38The velocity - time plot of the motion of a body is shown below: The acceleration (a) - time graph that best suits this motion is :2024Graphs of motion in one dimension
  39. 39Two heaters A and B have power rating of 1 kW and 2 kW , respectively. Those two are first connected in series and then in parallel to a fix2024Graphs of motion in one dimension
  40. 40A force defined by acts on a particle at a given time . The factor which is dimensionless, if and are constants, is:2024Dimensions
  41. 41A capacitor is connected to a source as shown in figure. The peak current in the circuit is nearly :2024Alternating Current, Voltage and Power
  42. 42A metallic bar of Young's modulus, and coefficient of linear thermal expansion , length 1 m and area of cross-section is heated from to with2024Young's Modulus and Breaking Stres
  43. 43A parallel plate capacitor is charged by connecting it to a battery through a resistor. If is the current in the circuit, then in the gap be2024Electromagnetic Waves and Maxwell's equations
  44. 44Choose the correct circuit which can achieve the bridge balance.2024Wheatstone Bridge
  45. 45A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magneti2024Magnetism and Properties of Magnet
  46. 46If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increases2024Capacitance
  47. 47The following graph represents the - curves of an ideal gas (where is the temperature and the volume) at three pressures and compared with t2024Gas Laws
  48. 48The property which is not of an electromagnetic wave travelling in free space is that:2024Electromagnetic Waves and Maxwell's equations
  49. 49An iron bar of length has magnetic moment . It is bent at the middle of its length such that the two arms make an angle with each other. The2024Magnetic Moment
  50. 50If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then t2024Time Period and Frequency

Zoology

  1. 1Match List I with List II Choose the correct answer from the options given below:2024Test Cross
  2. 2What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be 2024Tools of Recombinant DNA Technology
  3. 3Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene cry IAc. Statement II : Bt toxin exist2024Genetic Modified Crops
  4. 4A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024Transcription
  5. 5Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:2024Tools of Recombinant DNA Technology
  6. 6The equation of Verhulst-Pearl logistic growth is . From this equation, K indicates:2024Populations
  7. 7Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the2024Mendel's Work and Results
  8. 8A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?2024Incomplete Dominance
  9. 9In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with2024Test Cross
  10. 10Match List I with List II Choose the correct answer from the options given below:2024Products
  11. 11The lactose present in the growth medium of bacteria is transported to the cell by the action of2024Regulation of Gene Expression
  12. 12Match List I with List II Choose the correct answer from the options given below:2024Regulation of Gene Expression
  13. 13Which of the following statement is correct regarding the process of replication in E.coli?2024Transcription
  14. 14Match List I with List II : Choose the correct answer from the options given below :2024Structure of Human Brain
  15. 15Which of the following is not a component of Fallopian tube?2024Female Reproductive System
  16. 16The "Ti plasmid" of Agrobacterium tumefaciens stands for2024Tools of Recombinant DNA Technology
  17. 17Match List I with List II : Choose the correct answer from the options given below :2024Human Respiratory System
  18. 18Given below are two statements : one is labelled as Assertion and the other is labelled as Reason : Assertion A : FSH acts upon ovarian foll2024Female Reproductive System
  19. 19Match List I with List II : Choose the correct answer from the options given below :2024Separation and Isolation of DNA Fragments
  20. 20Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo n2024Human Evolution
  21. 21Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupu2024Immune System Disorder
  22. 22Match List I with List II : Choose the correct answer from the options given below :2024Common Health Disease
  23. 23Three types of muscles are given as and c . Identify the correct matching pair along with their location in human body: Name of muscle/locat2024Muscle Tissue
  24. 24Match List I with List II : {array}{|l|l|l|l|} & List I & & List II \\ A. & Down's syndrome & I. & 11^{ {th }} chromosome \\ B. & -Thalassem2024Genetic Disorders
  25. 25Which of the following statements is incorrect?2024Separation and Isolation of DNA Fragments
  26. 26The following diagram showing restriction sites in . coli cloning vector pBR322. Find the role of ' and ' genes:2024Tools of Recombinant DNA Technology
  27. 27Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hy2024Female Reproductive System
  28. 28Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to2024Mammalian Urinary System
  29. 29In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on2024Cockroach
  30. 30Match List I with List II : Choose the correct answer from the options given below :2024Locomotion
  31. 31Which of the following is not a steroid hormone?2024Testis
  32. 32Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. Purkinje fibres C. AV node D. Bu2024Human Circulatory System
  33. 33Match List I with List II {array}{|l|l|l|l|} & List I & & List II \\ A. & Non-medicated IUD & I. & Multiload 375 \\ B. & Copper releasing IU2024Population Explosion and Birth Control
  34. 34Which of the following is not a natural/traditional contraceptive method?2024Population Explosion and Birth Control
  35. 35Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA52024Transcription
  36. 36Which one of the following factors will not affect the Hardy-Weinberg equilibrium?2024Modern Theory of Evolution
  37. 37Match List I with List II : Choose the correct answer from the options given below:2024Drug Abuse
  38. 38Match List I with List II : {array}{|l|l|l|l|} & List I & & List II \\ A. & Typhoid & I. & Fungus \\ B. & Leishmaniasis & II. & Nematode \\ 2024Common Health Disease
  39. 39Match List I with List II : Choose the correct answer form the options given below:2024Genetic Modified Crops
  40. 40Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Breast-feeding during i2024Female Reproductive System
  41. 41The flippers of the Penguins and Dolphins are the example of the2024Evidences of Evolution
  42. 42Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?2024Human Respiratory System
  43. 43Match List I with List II: Choose the correct answer from the options given below:2024Epithelial Tissue
  44. 44Choose the correct statement given below regarding juxta medullary nephron.2024Mammalian Urinary System
  45. 45Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.2024Embryology
  46. 46Match List I with List II : {array}{|l|l|l|l|} & List I & & List II \\ A. & P wave & I. & Heart muscles are electrically silent. \\ B. & QRS2024Electrocardiograph
  47. 47Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produc2024Lymph
  48. 48Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for d2024Populations
  49. 49Match List I with List II : {array}{|l|l|l|l|} & List I & & List II \\ A. & Exophthalmic goiter & I. & Excess secretion of cortisol, moon fa2024Thyroid
  50. 50Match List I with List II related to digestive system of cockroach. Choose the correct answer from the options given below:2024Cockroach
  51. 51As per ABO blood grouping system, the blood group of father is , mother is and child is . Their respective genotype can be A. B. C. D. E. Ch2024Blood Group
  52. 52Match List I with List II: Choose the correct answer from the options given below :2024Transcription
  53. 53Match List I with List II: Choose the correct answer from the options given below :2024Geological Timescale
  54. 54Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II: T2024Structure of Human Brain

Frequently Asked Questions

1.How many questions are in the NEET 2024 paper?

This paper has 200 questions in total - 46 from Botany, 50 from Chemistry, 50 from Physics, and 54 from Zoology.

2.Can I practise questions from just one subject?

Yes. Use the Botany, Chemistry, Physics, and Zoology tabs at the top of the page to jump directly to that subject's question set within this paper.

3.Where can I find the Re-NEET paper for the same year?

The NEET 2024 Re-NEET paper is listed separately - you can switch to it from the "NEET Paper Wise PYQs" panel, under null.

4.What is the structure of the NEET 2024 paper?

The NEET 2024 paper on MARKS has 200 questions, organised by subject:

  • Botany: 46 questions - 46 single-correct.
  • Chemistry: 50 questions - 50 single-correct.
  • Physics: 50 questions - 50 single-correct.
  • Zoology: 54 questions - 54 single-correct.
5.What is the difficulty level of the NEET 2024 paper?

Each question on MARKS carries a difficulty rating. Of the 200 rated questions in this paper, 75 (38%) are easy, 113 (56%) are medium and 12 (6%) are hard. Subject wise:

  • Botany: 13 easy, 31 medium, 2 hard
  • Chemistry: 25 easy, 18 medium, 7 hard
  • Physics: 18 easy, 29 medium, 3 hard
  • Zoology: 19 easy, 35 medium, 0 hard
6.Which chapters had the most questions in the NEET 2024 paper?

The chapters with the most questions in each subject were:

  • Botany: Biodiversity and its Conservation (7), Biomolecules (B) (5), and Morphology of Flowering Plants (5).
  • Chemistry: Chemical Bonding and Molecular Structure (4), d and f Block Elements (4), and General Organic Chemistry (4).
  • Physics: Current Electricity (3), Magnetic Effects of Current (3), and Semiconductors (3).
  • Zoology: Biotechnology - Principles and Processes (6), Molecular Basis of Inheritance (6), and Human Reproduction (5).
7.Where can I find the solutions for the NEET 2024 paper?

Open any question on this page. Its page shows the correct answer and, where one is available, the worked solution. A downloadable PDF of the whole paper is coming soon.

8.How should I use the NEET 2024 paper to check my preparation?

Set a timer, attempt the 200 questions as you would in the exam, and only then open the answers. Note which subjects and chapters cost you the most marks, and revise those first using the chapter-wise practice for NEET. Repeating this with other papers shows whether the same weak spots keep coming back.

9.Will the NEET 2024 paper help me prepare for NEET 2027?

Yes. Every past paper shows the question styles and topics NEET has asked before, and a solved paper gives you a realistic benchmark for speed and accuracy. Use it along with the other papers to spot the chapters that keep returning.