Jump to a section

NEST (NISER) 2021 Session 2

Browse the complete Biology, Chemistry, Mathematics, and Physics question set from the NEST (NISER) 2021 Session 2 paper, question by question. Each question shows a quick preview so you can jump straight to the topic or subject you want to revise. Click through to attempt the full question in practice mode, or head back to the paper-wise list to download the entire paper as a PDF.

This paper has 68 questions in total - 5 easy (7%), 49 moderate (72%) and 14 tough (21%). That's a fairly typical mix for this exam. By subject: Biology 18% easy, 76% moderate, 6% tough; Chemistry 0% easy, 88% moderate, 12% tough; Mathematics 12% easy, 65% moderate, 24% tough; Physics 0% easy, 59% moderate, 41% tough.

Biology questions were spread across 12 chapters, with Molecular Basis of Inheritance (3), Biological Classification (2), and Biomolecules (B) (2) carrying the most weight. Chemistry questions were spread across 12 chapters, with Amines (2), Chemical Bonding and Molecular Structure (2), and Hydrocarbons (2) carrying the most weight. Mathematics questions were spread across 11 chapters, with Sets and Relations (3), Definite Integration (2), and Quadratic Equation (2) carrying the most weight. Physics questions were spread across 13 chapters, with Electrostatics (2), Nuclear Physics (2), and Thermodynamics (2) carrying the most weight.

Biology

  1. 1A double-stranded DNA template with sequence 5'GCCATGAACTAGCTTCGATCGATGCTTGCCTACGTCAGTC3' was PCR-amplified using forward (5'GAACTA3') and r2021 (Session 2)Replication
  2. 2Some characteristic features [presence and absence ] of certain organisms belonging to various categories and are listed (Table). The catego2021 (Session 2)Kingdom Monera
  3. 3Sterilization is the process in which all living organisms, including microbial endospores, are destroyed. A disinfectant is an antimicrobia2021 (Session 2)Biocontrol Agents
  4. 4Passiflora plant produces toxic glucosides that protect its leaves from several insects. However, Heliconius caterpillars sequester these co2021 (Session 2)Populations
  5. 5A protein with isoelectric point 6.5 was isolated. It was prepared in three different buffers and with and 8.5 , respectively. With respect 2021 (Session 2)Protein
  6. 6During an excursion, students found a non-woody flowering plant and wanted to classify it either as a monocotyledonous or eudicotyledonous. 2021 (Session 2)The Flower
  7. 7An angiosperm plant of genotype ppQqRRSS pollinates another plant with genotype PPQQRRss. If the genes are not linked, the genotype of the e2021 (Session 2)Sexual Reproduction
  8. 8Oxidative phosphorylation is carried out by electron transport chain (ETC) present in the mitochondria of aerobes. The NADH or FADH2 produce2021 (Session 2)Aerobic Respiration
  9. 9DNA fingerprinting was performed on a human skeleton (S) to identify a missing person reported by four different families (F1, F2, F3 and F42021 (Session 2)DNA Fingerprinting
  10. 10In four separate experiments (Table), a vector DNA pBxyz ( 6000 bp ) and a DNA-X (1500 bp) fragment was digested with the indicated restrict2021 (Session 2)Tools of Recombinant DNA Technology
  11. 11The 2020 Nobel prize in chemistry was awarded for the CRISPR/Cas9 system. This concept was derived from2021 (Session 2)Conceptual Development of Genetic Engineering
  12. 12The CENTN1 gene encodes the protein centrin that is localized to the centriolar apparatus. Mutation in this gene may give rise to dysfunctio2021 (Session 2)Mutation
  13. 13The family tree of Lemurs split off from the Last Common Primate Ancestor (LCPA) as 'wet-nosed monkeys', while the other branch of 'dry-nose2021 (Session 2)Evidences of Evolution
  14. 14During evolution, the mitochondrial genome lost many genes, and some of these got incorporated into the nuclear genome. Proteins synthesized2021 (Session 2)Cell Organelles
  15. 15A researcher determined the initial velocity of an enzyme in three different reactions (corresponding to lines and in the graph) with increa2021 (Session 2)Enzymes
  16. 16In the given pedigree, circles represent females and squares represent males. Filled shapes indicate affected individuals for a particular t2021 (Session 2)Genetic Disorders
  17. 17Escherichia coli grown in liquid nutrient medium is infected with a virus at a concentration that will result in the entry of a single virus2021 (Session 2)Viruses

Chemistry

  1. 1Consider the following reactions (unbalanced) In the N -oxides ( and Z ), the oxidation state of nitrogen increases in the order2021 (Session 2)Nitrogen and Its Compounds
  2. 2Metal ' X ' reacts with dilute sulphuric acid to liberate gas ' Y '. It also reacts with aq. NaOH to give ' Y '. Metal ' X ' is2021 (Session 2)General Characteristics of Alkali Metals
  3. 3Group 16 elements form hydrides of the type and . The correct statement regarding these hydrides is2021 (Session 2)Sulphur and Its Compounds
  4. 4Among the following, the weakest -bond is2021 (Session 2)Covalent and Co-ordinate Bonding
  5. 5The product of the reaction of styrene with diborane , followed by reaction with alkaline hydrogen peroxide is2021 (Session 2)Reactions of alkenes
  6. 6To determine the exact amount of acetic acid in a sample, 1.5 g of the sample is titrated against 0.5 N solution of KOH . For the titration,2021 (Session 2)Quantitative measures in chemical equations
  7. 7A monoatomic ideal gas kept in a vessel fitted with a piston is expanded irreversibly from its initial state ( , at 300 K ) to the final sta2021 (Session 2)First Law and Basic Fundamentals of Thermodynamics
  8. 8The correct order of the wavelengths of the radiations, associated with the following, is2021 (Session 2)Hydrogen spectrum
  9. 9The compounds represented by the following two structures are2021 (Session 2)Isomerism of Organic Compounds
  10. 10Consider the following reaction The following data were obtained in a 500 ml flask at 300 K The rate of reaction (in Torr ) at is2021 (Session 2)Rate law and rate constant
  11. 11The composite is used to adsorb the phosphate pollutant in waste water. The adsorption capacity of composite for phosphate ions mass of phos2021 (Session 2)Adsorption isotherms
  12. 12Compound ' X ' reacts with nitrous acid to form ' Y ' . ' X ' on reaction with an excess of methyl iodide and then with moist silver oxide f2021 (Session 2)Preparation and Properties of Amines
  13. 13In general, hard acids and hard bases are small in size and non-polarizable, whereas soft acids and soft bases are larger and more polarizab2021 (Session 2)Polarization
  14. 14The addition of hydrogen bromide to 1,3-butadiene at two different temperatures give two products in different amounts as given below. In th2021 (Session 2)Preparation and Reactions of Conjugate Dienes
  15. 15The correct statement(s) based on the reaction scheme given below is/are2021 (Session 2)Preparation and Properties of Amines
  16. 16A chromite ore ' P ' reacts with calcined soda to form a yellow coloured solution containing iron(III) oxide and compound ' '. This solution2021 (Session 2)Compounds of Transition Metals
  17. 17Graph 1 represents an emission spectrum of an antique species containing various metals ( and R ). The peaks marked as are due to transition2021 (Session 2)Electronic configuration

Mathematics

  1. 1Let with be a point on the ellipse , (where ), whose foci are and . The normal at intersects the major axis at . If then equals2021 (Session 2)Equation of Ellipse
  2. 2The function is defined as follows2021 (Session 2)Continuity
  3. 3If and , then the number of elements in is2021 (Session 2)Questions on number of relations and sets
  4. 4NISER and CEBS anticipate admission of 200 students in the next semester and plans to offer jointly a number of online courses in both the p2021 (Session 2)Combination
  5. 5A group of 5 students, X, Y, Z, P, Q, have the following combination of two subjects each in their first year of college. X studies Physics 2021 (Session 2)Questions on number of relations and sets
  6. 6The real values of for which the points and are coplanar are:2021 (Session 2)Line in Space
  7. 7If , then one of the possible values of is2021 (Session 2)Basic
  8. 8The number of solution(s) of the equation is/are2021 (Session 2)Solving Trigonometric Equation
  9. 9The set of real numbers for which the inequality is valid, lie in the interval2021 (Session 2)Properties of Definite Integration
  10. 10The number of positive integers such that is a perfect square is2021 (Session 2)Arithmetic Progression
  11. 11The polynomial has2021 (Session 2)Descartes Rule of Sign
  12. 12Let be all the positive divisors of . If , then equals2021 (Session 2)Arithmetic Progression
  13. 13Two distinct complex numbers are such that the roots of are squares of the roots of . Let and . Then is2021 (Session 2)Relation between Roots and Coefficients
  14. 14Let where is a positive integer. Then2021 (Session 2)Properties of Definite Integration
  15. 15Let be three mutually orthogonal unit vectors. Let and . Then2021 (Session 2)Algebra of Vectors
  16. 16Let be a function. If and , define and . Then the true statement/statements is/ are2021 (Session 2)Questions on number of relations and sets
  17. 17For a square matrix , let be the determinant of and let be the transpose of the matrix . If and are two invertible real matrices, then the c2021 (Session 2)Adjoint and its Properties

Physics

  1. 1A car in one dimensional motion with initial speed is accelerated with constant acceleration for a distance . Each time the car travels a di2021 (Session 2)Energy
  2. 2Consider two identical circular solenoids, each of length , radius and total number of turns . The solenoids are on the same axis and distan2021 (Session 2)Self and Mutual Inductance
  3. 3A scientist found a specimen in which the decay constant of nuclei X and nuclei Y are and respectively. At the number of X and Y nuclei were2021 (Session 2)Radioactivity
  4. 4A refrigerator with a 50 W motor is to be used to freeze 2 kg of water at 273 K in an insulated vessel. The outside temperature is 300 K . T2021 (Session 2)Heat Engine, Refrigerator and<br>Second Law of Thermodynamics
  5. 5Suppose you are doing a diffraction experiment using a white light source on a piece of grating in which the number of grooves is 10,000 lin2021 (Session 2)Diffraction of Light
  6. 6Two point charges and are located at and respectively. Assume that the potential is vanishing at infinity. The correct statement about the s2021 (Session 2)Electric Potential and Potential Energy
  7. 7In a radioactive decay, Plutonium disintegrates to and an particle. After the disintegration the mass difference between the parent nucleus 2021 (Session 2)Radioactivity
  8. 8Certain theoretical calculations using quantum and relativistic concepts show that an accelerating observer (with constant linear accelerati2021 (Session 2)Dimensions
  9. 9A bimetallic strip of lead and nickel has a total thickness of each). The strip is straight at a temperature of 300 K . The coefficient of l2021 (Session 2)Thermal Expansion
  10. 10A mass of 2 Kg hangs vertically from the end of a string of mass 0.4 Kg and length 2 m . The time, a transverse pulse will take to travel fr2021 (Session 2)Basics of Mechanical Waves
  11. 11A ray of light is incident perpendicularly at point A on a rectangular medium with different refractive indices, and , in a configuration as2021 (Session 2)Refraction of light from plane surface
  12. 12Two point beads of mass each are free to slide on a horizontal rod of length and mass . Initially, the beads are at the center of the rod an2021 (Session 2)Angular momentum and Angular impulse
  13. 13Consider four identical monochromatic wave sources (as shown in the figure) which produce plane waves of same wavelength . Sources and C lie2021 (Session 2)Interference of Light
  14. 14In an experiment, 1 kg of water, initially at 283 K is heated to 363 K via two processes. In process I, water is brought into contact with a2021 (Session 2)First Law of Thermodynamics
  15. 15Consider a universe with modified electrostatics where like charges attract and unlike charges repel. Three positively charged point particl2021 (Session 2)Electric Charge and Coulomb's law
  16. 16A nozzle is situated at a distance of 5.6 m above the ground level and is pointed up at angle of 45 degrees to the horizontal. The diameter 2021 (Session 2)Projectile motion
  17. 17A particle with electric charge moves in a magnetic field with velocity . Here is a non-zero constant and . Select the correct statement(s).2021 (Session 2)Motion of Charged Particle in Magnetic Field

Frequently Asked Questions

1.How many questions are in the NEST (NISER) 2021 Session 2 paper?

This paper has 68 questions in total - 17 each from Biology, Chemistry, Mathematics, and Physics.

2.Can I practise questions from just one subject?

Yes. Use the Biology, Chemistry, Mathematics, and Physics tabs at the top of the page to jump directly to that subject's question set within this paper.

3.Where can I find the Session 1 paper for the same year?

The NEST (NISER) 2021 Session 1 paper is listed separately - you can switch to it from the "NEST (NISER) Paper Wise PYQs" panel, under NEST (NISER) 2021.

4.How is the NEST (NISER) 2021 Session 2 paper structured?

The NEST (NISER) 2021 Session 2 paper on MARKS has 68 questions, organised by subject:

  • Biology: 17 questions - 12 single-correct and 5 multiple-correct.
  • Chemistry: 17 questions - 12 single-correct and 5 multiple-correct.
  • Mathematics: 17 questions - 12 single-correct and 5 multiple-correct.
  • Physics: 17 questions - 12 single-correct and 5 multiple-correct.
5.How difficult is the NEST (NISER) 2021 Session 2 paper?

Each question on MARKS carries a difficulty rating. Of the 68 rated questions in this paper, 5 (7%) are easy, 49 (72%) are medium and 14 (21%) are hard. Subject wise:

  • Biology: 3 easy, 13 medium, 1 hard
  • Chemistry: 0 easy, 15 medium, 2 hard
  • Mathematics: 2 easy, 11 medium, 4 hard
  • Physics: 0 easy, 10 medium, 7 hard
6.Which chapters were asked the most in the NEST (NISER) 2021 Session 2 paper?

The chapters with the most questions in each subject were:

  • Biology: Molecular Basis of Inheritance (3), Biological Classification (2), and Biomolecules (B) (2).
  • Chemistry: Amines (2), Chemical Bonding and Molecular Structure (2), and Hydrocarbons (2).
  • Mathematics: Sets and Relations (3), Definite Integration (2), and Quadratic Equation (2).
  • Physics: Electrostatics (2), Nuclear Physics (2), and Thermodynamics (2).
7.Where can I find the solutions for the NEST (NISER) 2021 Session 2 paper?

Open any question on this page. Its page shows the correct answer and, where one is available, the worked solution. A downloadable PDF of the whole paper is coming soon.

8.How should I use the NEST (NISER) 2021 Session 2 paper to check my preparation?

Set a timer, attempt the 68 questions as you would in the exam, and only then open the answers. Note which subjects and chapters cost you the most marks, and revise those first using the chapter-wise practice for NEST (NISER). Repeating this with other papers shows whether the same weak spots keep coming back.

9.Will the NEST (NISER) 2021 Session 2 paper help me prepare for NEST (NISER) 2027?

Yes. Every past paper shows the question styles and topics NEST (NISER) has asked before, and a solved paper gives you a realistic benchmark for speed and accuracy. Use it along with the other papers to spot the chapters that keep returning.